Effect of Carbamazepine Drug on the Expression of miR373 and miR222 Genes in the Testis of the MIC

Elaheh Raji, Ali Mohammad Ahadi* and Marzieh Akbari

Published Date: 2023-08-07

Elaheh Raji1, Ali Mohammad Ahadi2* and Marzieh Akbari2

1Department of Biology, Islamic Azad University,Tehran, Iran

2Department of Genetics, Shahrekord University, Shahrekord, Iran

*Corresponding Author:
Ali Mohammad Ahadi
Department of Genetics,
Shahrekord University,
Shahrekord,
Iran;
E-mail:
ahadi_al@sku.ac.ir

Received date: May 28, 2023, Manuscript No. IPJREI-23-16833; Editor assigned date: May 31, 2023, PreQC No. IPJREI-23-16833 (PQ); Reviewed date: June 14, 2023, QC No. IPJREI-23-16833; Revised date: July 31, 2023, Manuscript No. IPJREI-23-16833 (R); Published date: August 07, 2023, DOI: 10.36648/2476-2008.8.3.056

Citation: Raji E, Ahadi AM, Akbari M (2023) Effect of Carbamazepine Drug on the Expression of miR373 and miR222 Genes in the Testis of the MIC. J Reproductive Endocrinal and Infert Vol:8 No:4

Visit for more related articles at Journal of Reproductive Endocrinology & Infertility

Abstract

Infertility is a major health problem worldwide, and it is estimated that infertility affects 8 to 12% of marriages worldwide. Infertility can be defined as pregnancy after at least 12 months of regular and unprotected gender. Approximately 15% of couples are infertile and in these couples the male factor usually accounts for 50% of the causes of infertility. Infertility in men is one of the several factors that play a role in disorders. Two groups of male Balb/C mice was involved in this study including control and treatment groups. Carbamazepine drug was used orally and mixed with rat food in the treatment group. Finally, the testis of treatment and control animals was dissected and subjected to a relative Real-time RT-PCR analysis for calculation of miR373 and miR222 genes expression changes analysis. Our results showed that carbamazepine can disrupt the normal growth of male gonads and a significant increasing rate in the expression of miR373 gene compared with the control group (Sig.=0.000, P ≤ 0.05, CI=95%). There is no significant change in miR222 gene expression. These findings are supported by previously reports about the role of these genes. Considering the result of this study, followup for infertility in men that are on carbamazepine diet is necessary.

Keywords

Carbamazepine; Infertility; Gene expression analysis; Pregnancy; Gene

Introduction

Infertility is a major health problem worldwide, and it is estimated that infertility affects 8 to 12% of marriages worldwide. Infertility can be defined as pregnancy after at least 12 months of regular and unprotected gender [1]. Approximately 15% of couples are infertile, and in these couples the male factor usually accounts for 50% of the causes of infertility. Infertility in men is one of the several factors that play a role in disorders [2]. About 40% of women's infertility problems are related to men. For 60 to 75% of men, the obvious cause of infertility is indistinguishable, resulting in the term "idiopathic male infertility" [3]. Different factors such as congenital factors including cryptorchidism, Y chromosome microdeletions, chromosomal or genetic abnormalities, kleinfelter syndrome and its types kalman syndrome, Robertson’s transmission, mild insensitivity syndrome Aadrogens, genetic endocrinopathy, congenital obstruction and acquired factors including varicocele, testicular trauma, testicular torsion, germ cell tumors, acquired hypogonadotrophic hypogonadism, recurrent urogenital tract infections, obstructive urogenital tract can cause infertility in men. Also, cancer chemotherapy, drugs, radiation, heat and idiopathic risk factors such as smoking, alcohol and obesity may induce some types of on fertility [4]. In men, genetic abnormalities can cause infertility by affecting sperm production or sperm transfer [5]. The most common genetic causes of infertility in men are single-gene mutations (such as cystic fibrosis), chromosomal abnormalities, and Ychromosome microdeletions [6]. It is estimated that about 2,000 genes control this process, most of which are located on autosomal chromosomes, and about 30 genes are located on the Y chromosome. Several X-related genes are expressed in the testis and have been suggested to play a role in spermatogenesis. Mutation in some of the important genes including CFTR, DAX1, GATA4, WNT4, WT1, AKAP82, HBB, KALIG-1, HAMP, HFE, HFE2, SLC40A1, TFR2, SOX9 can lead to male infertility. SOX9 regulates maturation of sertoli cells. Sertoli cell immaturity and inability to support the final stages of spermatogenesis cause infertility. Therefore, decreased SOX9 expression can be one of the causes of male infertility [7]. Testicular growth and function are controlled by hormones, cytokines and growth factors [8]. TGFβ1 can modulate androgen synthesis in leydig cells by regulating the expression of human Chorionic Gonadotropin receptor (hCG) and modulating steroidogenic enzymes including P450 17α-hydroxylase/C17-C [9]. Mice lacking TGFβ1 have been shown to suffer from complete infertility due to impaired LH secretion, which leads to decreased testosterone levels and acts in coordination with testosterone-independent sexual dysfunction. Spermatogenesis depends on the epigenetic and genetic regulation of male germ cell. Recently, a number of microRNAs have been identified in human testicular tissues and are closely related to male fertility [9]. One of these molecules is miR373 at chromosomal position 19q13. 4 that belongs to the miR371-3 gene cluster. To date, the role of miR373 in the processes of regulating cell proliferation, apoptosis, aging, mesododerm differentiation, migration and invasion, as well as in the miRNA response induced by hypoxia has been identified [10]. miR373 performs its functions by pairing with 3 'Untranslated (UTR) regions of mRNA after transcription and reduces gene expression, or by binding to target DNA promoters, positively regulates mRNA expression [11]. microRNA through SIRT1 gene and TGFRB2 gene can reduce the expression of SOX9 gene and play a role in infertility [12]. Upregulation of miR222 represses cell cycle progression and induces the apoptosis of immature porcine sertoli cells, whereas inhibition of miR222 lead to the cell proliferation. Also, both miR222 overexpression represses the phosphorylation of PI3K and AKT and suppresses immature porcine sertoli cell growth by targeting the GRB10 gene [13].

Reproductive disorders are more common among men with epilepsy than the general population. Epilepsy is one of the most common neurological diseases, and researchers around the world have reported epilepsy as being associated with genital disorders and the possibility of endocrine and reproductive and sexual endocrine disorders [14]. According to current results, men with epilepsy may experience changes in serum gonadotropin and testosterone levels that may affect sperm quality. Epilepsy with adverse effects on the nervous system, as well as on the production of male hormones and the psychological stress that follows, as well as the adverse effects of drugs used to control epilepsy cause sexual dysfunction in men. Epilepsy disrupts the secretion of hormones from the hypothalamus and pituitary gland and the production of hormones by the testes [15]. Taking medications prescribed for these patients, including carbamazepine, increases the concentration of serum Gender Hormone Binding Globulin (GHBG) in men and women with epilepsy. Over time, elevated Serum levels (SHBG) lead to decreased biological activity of testosterone and estradiol, which may lead to decreased sexual potency in men and menstruation in women as a result of reduced fertility [16]. Carbamazepine is the most widely used antiepileptic drug that is widely used in patients with epilepsy [17].

Material and Methods

Maintenance and preparation of mice

Ten the male BALB/c mice with 25 ± 5 gram and 1.5-2 months were prepared as model animals in this study. The animals were maintained at temperature 25℃ on a 12 h light/dark cycle. All animals received humane care in compliance with the guidelines of the animal care and use committee. The ethics committee of the Shahrekord university (approval ID. IR.SKU.REC.1399.012) approved the research. Two groups with 5 members randomly were selected. The first group was identified as the Treatment group (T) with CBZ and the second group as the Control group (C).

Calculation of CBZ dose

To evaluate the effect of CBZ, it was used orally and mixed with rat food. The dose of CBZ was calculated in two doses over two 7 day periods (14 days in total) (Table 1).

Period Dose Time
First 0.057 mg/Kg 7 day
Second 0.114 mg/Kg 7 day

Table 1: Time and dose of CBZ.

Tissue sampling, RNA isolation, and cDNA synthesis

After 14 days, testes were dissected from the studied groups. Tissue samples were transferred to a -70 freezer. Total RNA was isolated from the testis of mice model using the TriZol total RNA extraction kit (Fermentas, USA) according to the manufacturer’s instructions. The purity of extraction RNA was measured with a NanoDrop™ 1000 Spectrophotometer (Thermo fisher scientific, USA). Then cDNA was synthesized using a cDNA synthesis kit (TaKaRa, Japan) according to the manufacturer’s instructions.

Real-Time RT-PCR

Subsequently, Real-time RT-PCR was performed in order to the expression of genes in the testes. U6 noncoding RNA gene was selected as an interior control. Primers used are shown in Table 2. Amplification for all reactions in this study was performed under this condition.

An initial denaturation at 95℃ for 15 seconds, followed by 40 amplification cycles including denaturation at 95℃ for 20 s, annealing for 30 s dependent on primer TM for all genes and 25 s at 72℃ for extension. The quality of fragments was confirmed by agarose gel electrophoresis.

Primer name Sequence Target length Target gene Accession no.
RT-Primer AATATGGAACGCTTCACGAATTTG 104 bp U6 XR_008330775.1
F-Primer GTGCTCACTTCGGCAGCAC
R-Primer AATATGGAACGCTTCACGAATTTG
RT-Primer CCGACGAATACCCTCTGGTACAGCTAGAAGATGCCATCAG 131 bp miR222 MIPF0000051
F-Primer GCTGCTGGAAGGTGTAGGTAC
R-Primer CCGACGAATACCCTCTGGTAC
RT-Primer CTTCCATCCTGAGCTAGTACGGGACACCCCAAAATCGAAGC 89 bp miR373 MI0000781 
F-Primer GGGATACTCAAAATGGGG
R-Primer CTTCCATCCTGAGCTAGTAC

Table 2: Primer sequences used for amplification of the target genes.

Gene expression and statistical analyses

Expression changes of studied genes was calculated based on 2-ΔΔCt method [18]. All results are given as the mean ± SEM. Kolmograph-Smirnov method was used for normality assay of given data. Probabilities of chance differences between two groups were calculated using an independent t-test.

Results

As described in material and method, total RNA was extracted by using RNXplus solution and qualified in gel electrophoresis (Figure 1). 28s and 18s rRNA shows an optimal quality of the extracted RNA.

IPJREI-RNA

Figure 1: Separation and analysis of RNA. Green viewer-stained 1% TBE agarose gel showing RNA extracted from testis tissue of treated mice. M: 100 bp DNA size marker.

Figure 2 shows the melt curves for target genes amplicons. The single peak is typically interpreted as representing a pure, single amplicon. Also, amplification plot for every genes is showed.

IPJREI-Melt

Figure 2: Melt curves and Amplification plots for the reference (ActB) and targeted amplicons of the studied genes. a) U6; b) miR222 and; c) miR373.

As mentioned in this study, the expression changes of AdipoQ, Glut 4, miR373 and Mir373 genes as candidate genes involved in the metabolism of lipids and carbohydrates under the administration of carbamazepine were measured in testis by the 2-ΔΔCt method [19]. Using graphpad prism 9.0.0 software, the statistical independent t-test method was carried out and the research hypothesis was tested and the results were presented. The distribution of data for the results of gene expression changes between control group and the animals treated with carbamazepine was performed by Simonov kolmograph test using SPSS version 26. Figures 3a and 3b, show the result of MIR322, Mir373 and Mir373 genes expression analysis.

IPJREI-Gene

Figure 3: Gene expression changes between control and carbamazepine treated groups. a) miR373 gene showed two fold increase in expression compared to the control group (P ≤ 0.001, Sig.=0.000); b) miR222 gene expression with no significant change (P ≤ 0.05, Sig.=0.01, fold change=0.274) compared to the control group.

Discussion

Hormonal changes that can be caused by epilepsy include increased gender hormone bonding globulin, decreased free androgen index, impaired pulmonary gonadotropin secretion, and impaired dopamine secretion leading to hypogonadism, which can be associated with sexual dysfunction. Genetic factors may be important in sperm changes in men with epilepsy [20]. In addition, the number of people with normal sperm is low among people with epilepsy. If there are any abnormalities in the sperm, fertility can be compromised. In addition, men with epilepsy are five times more likely to have erectile dysfunction than men without epilepsy. The results of the first prospective study of the long-term effects of CBZ on serum androgen levels and sexual function in men with epilepsy showed that serum SHBG levels gradually increased during long-term CBZ treatment while serum testosterone levels remained unchanged. As a result, an increase in SHBG continuously decreases the free androgen release of Ramanger serum. The results of a study showed that patients treated with CBZ had significantly higher SHBG levels and lower FAI levels and DHEAS concentrations. Levels of LH, FSH, PRL or E2 were not different in male patients with epilepsy treated with CBZ and untreated with the control group. CBZ use alone does not significantly alter the serum balance of gender hormones. However, CBZ clearly affects serum SHBG and DHEAS levels. Many studies have shown changes in the testicles and the incidence of infertility and sperm deformity in people treated with carbamazepine.

In this study, we investigated the effect of carbamazepine drug on the expression of four key genes in metabolism balance of lipids and carbohydrates. Several studies indicated that carbamazepine can promote hyperglycemia in human and animal. In a study in the rats, carbamazepine significantly increased fasting plasma glucose, insulin resistance index, total cholesterol and triglycerides compared with the control group. This phenomena is very important in about diabetic patients and the peoples that affected by obesity. We proposed here that this effects may resulted from an interference between the carbamazepine drug and gene expression profile in testis. As a simple view, adiponectin has been shown to enhance insulin sensitivity in several reports that result in entrance of glucose into the adipocytes and testis cells. In this situation, miR373 hormone acts in reverse direction in releasing of glucose into the blood stream. In our study gene expression showed 15 times increase (P ≤ 0.0001) compared to the control group. Adiponectin level elevates with hyperglycemia independent of body size. Optimization of blood glucose in the hyperglycemic patients that tolerate decrease in adiponectin levels is independent of diabetes type and/or body weight. Adiponectin played a critical role in regulating plasma glucose and reducing pancreatic islet apoptosis after gastric bypass surgery. So, increasing of adiponectin that we reported in this study, may be a secondary or compensation result of hyperglycemia. In this situation, the body may changes its metabolic source from glucose consumption to lipid catabolism. Other result of our study, decreasing of miR322 gene expression to 0.4 times (P ≤ 0.001) compare to control group, is compatible with this hypothesis. Also, in this study, we investigated the expression change of Adiponectin and miR373 genes under the carbamazepine diet. Adiponectin/miR373 balance is one of the most important indexes for an optimal metabolic condition in the body. Results of this study showed decreasing of miR373 to 0.76 (P ≤ 0.05) compare to control group. This decreasing of miR373 level after the carbamazepine consumption, may be a result of glucose level elevation in blood that can induce a satiety situation result in decrease of miR373 production.

Similar to our findings, some studies indicated that carbamazepine cause diminish in level of miR373 in the patients’ blood. Carbamazepine and carbamazepine is two common antiepileptic drug. Decreasing of miR322 gene expression that we reported here, must be considered beside of miR373 diminish. Low level of miR373 in blood can lead to decreasing of insulin secretion and decreased miR322 gene expression. Previous researches showed that changes in miR322 gene expression under the high level of cAMP is accompanied by similar alterations in miR322 protein expression and glucose uptake, suggesting a role of miR322 gene expression in regulation of cellular insulin role in glucose transport. Based on this findings, we proposed that decreased mir373 that resulted from carbamazepine drug may be act through a cAMP manner. As supportive reports, correlation analysis indicated that the decrease in miR322 gene levels was only observed in hyperglycemic mice. On the other hand, the glucose catabolic related genes do not exhibit any clear coordinate expression. Agitated expression of glucose catabolic genes may contribute to hyperglycemia and muscle insulin resistance. Interestingly, a study showed that hyperglycemia correlate with increasing of GLUT1 protein, while, miR322 gene level is decreased under hyperglycemic condition. It seems, because of a wide role of miR373 hormone compared with restricted action of adiponectin, the expression changes in miR373 gene shows lower variance.

Conclusion

Finally we analyzed the expression of miR373 gene after treatment of animals with carbamazepine drug. Our result showed a more than 3 times increasing in expression for miR373 gene compare to control group of mice (P ≤ 0.001). miR373 is expressed in many mammalian tissues. Specially, during adipocyte differentiation in vitro, miR373 is expressed at a relatively high level in the early stages of adipogenesis, however its expression is gradually decreased at later stages. Thus, it is possible that Mir373 is necessary for the early stages of adipogenesis. Also miR373 has a well-defined role in phosphorylation and translocation of miR322 protein. This role can explains increasing of miR373 gene expression under carbamazepine consumption while miR322 gene level has decreased. On the other word, we think that, miR373 gene expression is increased to compensate the low level of miR322 protein. Considering the finding of this study, it can be concluded that carbamazepine is a relatively high-risk antiepileptic drug for obesity and metabolic syndrome, but more studies are needed.

Acknowledgement

We thank Shahrekord university for their collaborations.

Author Contributions

Laboratory work has done by Elaheh Raji. AMA participated as the group leader and the owner of the idea and the main author of the article. Marzieh akbari was collaborate as a part of laboratory work and animal treatments.

Conflict of Interests

The authors declare that they have no competing interests.

Ethical Declarations

The study has been approved by the ethical committee of Shahrekord University. Ethical code: IR.SKU.REC.1399.013.

Financial Support

No applicable.

References

open access journals, open access scientific research publisher, open access publisher
Select your language of interest to view the total content in your interested language

Viewing options

Flyer image

Share This Article